Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
320 records were found
miR-17HUMAN, RAT, MOUSEcaaagugcuuacagugcagguag SM-10032
miR-17 ControlSMC-10032
miR-132HUMAN, RAT, MOUSEuaacagucuacagccauggucg SM-10091
miR-132 ControlSMC-10091
miR-133aHUMAN, RAT, MOUSEuuugguccccuucaaccagcug SM-10051
miR-133a ControlSMC-10051
miR-135aHUMAN, RAT, MOUSEuauggcuuuuuauuccuauguga SM-10074
miR-135a ControlSMC-10074
miR-137HUMAN, RAT, MOUSEuuauugcuuaagaauacgcguag SM-10103
miR-137 ControlSMC-10103
miR-138HUMAN, RAT, MOUSEagcugguguugugaaucaggccg SM-10093
miR-138 ControlSMC-10093
miR-141HUMAN, RAT, MOUSEuaacacugucugguaaagaugg SM-10057
miR-141 ControlSMC-10057
miR-142-3pHUMAN, RAT, MOUSEuguaguguuuccuacuuuaugga SM-10115
miR-142-3p ControlSMC-10115
miR-18aHUMAN, RAT, MOUSEuaaggugcaucuagugcagauag SM-10132
miR-18a ControlSMC-10132
miR-143HUMAN, MOUSEugagaugaagcacuguagcuc SM-10035
miR-143 ControlSMC-10035
miR-144HUMAN, RAT, MOUSEuacaguauagaugauguacu SM-10121
miR-144 ControlSMC-10121
miR-145HUMAN, RAT, MOUSEguccaguuuucccaggaaucccu SM-10033
miR-145 ControlSMC-10033
miR-152HUMAN, RAT, MOUSEucagugcaugacagaacuugg SM-10136
miR-152 ControlSMC-10136
miR-153HUMAN, RAT, MOUSEuugcauagucacaaaagugauc SM-10137
miR-153 ControlSMC-10137
miR-191HUMAN, RAT, MOUSEcaacggaaucccaaaagcagcug SM-10061
miR-191 ControlSMC-10061
miR-9HUMAN, RAT, MOUSEucuuugguuaucuagcuguauga SM-10107
miR-9 ControlSMC-10107
miR-125a-5pHUMAN, RAT, MOUSEucccugagacccuuuaaccuguga SM-10174
miR-125a-5p ControlSMC-10174
Snord68MOUSE NR_028128SR-19001
SNORD43HUMAN NR_002439SR-19002
SNORD44HUMAN NR_002750SR-19003